Transcript: Human XM_011533434.2

PREDICTED: Homo sapiens prickle planar cell polarity protein 2 (PRICKLE2), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PRICKLE2 (166336)
Length:
8014
CDS:
38..2830

Additional Resources:

NCBI RefSeq record:
XM_011533434.2
NBCI Gene record:
PRICKLE2 (166336)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011533434.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000117230 GAGTCCTTGTATGCAGAATAT pLKO.1 947 CDS 100% 13.200 18.480 N PRICKLE2 n/a
2 TRCN0000421260 GTCTGACAACGAGGGCTATTT pLKO_005 2644 CDS 100% 13.200 18.480 N PRICKLE2 n/a
3 TRCN0000117228 GCCCTACCATTATGGGAACAA pLKO.1 1402 CDS 100% 4.950 6.930 N PRICKLE2 n/a
4 TRCN0000117229 CGAGTCCTTGTATGCAGAATA pLKO.1 946 CDS 100% 13.200 10.560 N PRICKLE2 n/a
5 TRCN0000430982 GGAGGACTATGACCAATTTAT pLKO_005 2455 CDS 100% 15.000 10.500 N PRICKLE2 n/a
6 TRCN0000435624 ATGACAATGAGGTTCGATATT pLKO_005 453 CDS 100% 13.200 9.240 N PRICKLE2 n/a
7 TRCN0000445333 GCGATGAGCTGCTGCACAAAT pLKO_005 2712 CDS 100% 13.200 9.240 N PRICKLE2 n/a
8 TRCN0000117231 CCAGAAGAGAAAGTCCCTTAT pLKO.1 374 CDS 100% 10.800 7.560 N PRICKLE2 n/a
9 TRCN0000117227 CCAGCTTAGTAACCAGAGTAT pLKO.1 4136 3UTR 100% 4.950 3.465 N PRICKLE2 n/a
10 TRCN0000087583 AGGAGGAAGAGGAAGAGGAAA pLKO.1 1716 CDS 100% 4.950 2.475 Y Adam32 n/a
11 TRCN0000156756 GAGGAAGAGGAAGAGGAAGAT pLKO.1 1718 CDS 100% 4.950 2.475 Y NPM2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011533434.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.