Transcript: Human XM_011533504.2

PREDICTED: Homo sapiens cullin associated and neddylation dissociated 2 (putative) (CAND2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CAND2 (23066)
Length:
4710
CDS:
236..3874

Additional Resources:

NCBI RefSeq record:
XM_011533504.2
NBCI Gene record:
CAND2 (23066)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011533504.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000257348 ACAGCGGTCAAGTTCCTTATC pLKO_005 3137 CDS 100% 10.800 15.120 N CAND2 n/a
2 TRCN0000236704 CCGACTCATTGAGCCACTAAG pLKO_005 3607 CDS 100% 10.800 15.120 N CAND2 n/a
3 TRCN0000236705 CGCACCCTGATCCAATGTTTG pLKO_005 866 CDS 100% 10.800 15.120 N CAND2 n/a
4 TRCN0000020912 CCGCACCCTGATCCAATGTTT pLKO.1 865 CDS 100% 5.625 7.875 N CAND2 n/a
5 TRCN0000020911 GCTGGTATCAGGCATCATCTT pLKO.1 1594 CDS 100% 4.950 6.930 N CAND2 n/a
6 TRCN0000020910 GCGGCCTTTGAATGCATGTAT pLKO.1 3428 CDS 100% 5.625 4.500 N CAND2 n/a
7 TRCN0000020913 CACAGCGGTCAAGTTCCTTAT pLKO.1 3136 CDS 100% 10.800 7.560 N CAND2 n/a
8 TRCN0000236706 CTGACTCTTTCTACAAGATTG pLKO_005 1755 CDS 100% 10.800 7.560 N CAND2 n/a
9 TRCN0000236707 TTAGCAAATTGGGCAACAATG pLKO_005 4511 3UTR 100% 10.800 7.560 N CAND2 n/a
10 TRCN0000020909 GCTGACTCTTTCTACAAGATT pLKO.1 1754 CDS 100% 5.625 3.938 N CAND2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011533504.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.