Transcript: Human XM_011534149.3

PREDICTED: Homo sapiens BRCA1 associated protein 1 (BAP1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BAP1 (8314)
Length:
3695
CDS:
153..2411

Additional Resources:

NCBI RefSeq record:
XM_011534149.3
NBCI Gene record:
BAP1 (8314)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011534149.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000007371 CGTCCGTGATTGATGATGATA pLKO.1 358 CDS 100% 5.625 7.875 N BAP1 n/a
2 TRCN0000007370 GCCACCATGTTGACATAAGTT pLKO.1 2764 3UTR 100% 5.625 7.875 N BAP1 n/a
3 TRCN0000007374 CCACAACTACGATGAGTTCAT pLKO.1 2225 CDS 100% 4.950 6.930 N BAP1 n/a
4 TRCN0000007372 CGTGGAAGATTTCGGTGTCAA pLKO.1 206 CDS 100% 4.950 6.930 N BAP1 n/a
5 TRCN0000435090 TGTTGACTGCATACGCTACAA pLKO_005 1772 CDS 100% 4.950 6.930 N BAP1 n/a
6 TRCN0000427717 AGAGCAAAGGATATGCGATTG pLKO_005 526 CDS 100% 6.000 4.800 N BAP1 n/a
7 TRCN0000417828 ATCATGCCACGGTCCCAACTA pLKO_005 2841 3UTR 100% 4.950 3.960 N BAP1 n/a
8 TRCN0000414307 GCAGCAGCTGATAAGAGTAAC pLKO_005 929 CDS 100% 10.800 7.560 N BAP1 n/a
9 TRCN0000412560 TCTTGGCTGAGAAGCTCAAAG pLKO_005 1492 CDS 100% 10.800 7.560 N BAP1 n/a
10 TRCN0000421661 TTTCCCAGTATTACTGAATAG pLKO_005 2489 3UTR 100% 10.800 7.560 N BAP1 n/a
11 TRCN0000007373 CCCTGTATATGGATTTATCTT pLKO.1 275 CDS 100% 5.625 3.938 N BAP1 n/a
12 TRCN0000030719 CCCTCAGTATTACCATGTCTT pLKO.1 3269 3UTR 100% 4.950 3.465 N Bap1 n/a
13 TRCN0000315583 CCCTCAGTATTACCATGTCTT pLKO_005 3269 3UTR 100% 4.950 3.465 N Bap1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011534149.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07218 pDONR223 100% 96.8% 96.9% None 366C>T;1889_1957del n/a
2 ccsbBroad304_07218 pLX_304 0% 96.8% 96.9% V5 366C>T;1889_1957del n/a
Download CSV