Transcript: Human XM_011534263.3

PREDICTED: Homo sapiens solute carrier family 4 member 7 (SLC4A7), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC4A7 (9497)
Length:
7688
CDS:
277..3645

Additional Resources:

NCBI RefSeq record:
XM_011534263.3
NBCI Gene record:
SLC4A7 (9497)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011534263.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000043161 CCAGTTATTTGACCGTATAAA pLKO.1 3048 CDS 100% 15.000 21.000 N SLC4A7 n/a
2 TRCN0000043160 GCAATTTAAGACCAAGCGTTA pLKO.1 2421 CDS 100% 4.050 5.670 N SLC4A7 n/a
3 TRCN0000335843 GTGTTATATTACTCGATTTAC pLKO_005 2040 CDS 100% 13.200 10.560 N SLC4A7 n/a
4 TRCN0000369213 ATTGAACCAAGAGGCATTATA pLKO_005 3647 3UTR 100% 15.000 10.500 N SLC4A7 n/a
5 TRCN0000043158 GCTCCCTTTAACCATATAATT pLKO.1 5155 3UTR 100% 15.000 10.500 N SLC4A7 n/a
6 TRCN0000335958 TGGTCATCATGGACCTTATAT pLKO_005 2334 CDS 100% 15.000 10.500 N SLC4A7 n/a
7 TRCN0000369212 TTTCCATGATGTAGCTTATAA pLKO_005 1380 CDS 100% 15.000 10.500 N SLC4A7 n/a
8 TRCN0000369139 CCGCTCTGGAAGGTCCATATT pLKO_005 3124 CDS 100% 13.200 9.240 N SLC4A7 n/a
9 TRCN0000335876 TAATCCTTGGTGGACCTTATT pLKO_005 2613 CDS 100% 13.200 9.240 N SLC4A7 n/a
10 TRCN0000043162 CCATGAAATTGGACGATCAAT pLKO.1 1335 CDS 100% 5.625 3.938 N SLC4A7 n/a
11 TRCN0000043159 GCAATGAAACTCTAGCACAAT pLKO.1 2216 CDS 100% 4.950 3.465 N SLC4A7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011534263.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.