Transcript: Human XM_011534672.2

PREDICTED: Homo sapiens 5-phosphohydroxy-L-lysine phospho-lyase (PHYKPL), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PHYKPL (85007)
Length:
1766
CDS:
144..1403

Additional Resources:

NCBI RefSeq record:
XM_011534672.2
NBCI Gene record:
PHYKPL (85007)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011534672.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000151359 GTTGAGTACTTCAACACGTTT pLKO.1 960 CDS 100% 0.495 0.693 N PHYKPL n/a
2 TRCN0000151788 CTAAGTGTACTCCAGAAGAAA pLKO.1 1420 3UTR 100% 5.625 3.938 N PHYKPL n/a
3 TRCN0000120403 GCATGACAACATCGTGGACTA pLKO.1 275 CDS 100% 4.050 2.835 N Phykpl n/a
4 TRCN0000336265 GCATGACAACATCGTGGACTA pLKO_005 275 CDS 100% 4.050 2.835 N Phykpl n/a
5 TRCN0000155023 GCCATTCTGACTGACATGGAA pLKO.1 1341 CDS 100% 3.000 2.100 N PHYKPL n/a
6 TRCN0000155771 CCTGAATGTCTTGGAGAAGGA pLKO.1 1019 CDS 100% 2.640 1.848 N PHYKPL n/a
7 TRCN0000150658 GAGGAACATCCTGAAGTTTAA pLKO.1 1265 CDS 100% 13.200 7.920 N PHYKPL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011534672.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04466 pDONR223 100% 88.9% 88.6% None 0_1ins123;579_608del n/a
2 ccsbBroad304_04466 pLX_304 0% 88.9% 88.6% V5 0_1ins123;579_608del n/a
Download CSV