Transcript: Human XM_011534931.1

PREDICTED: Homo sapiens poly(ADP-ribose) polymerase family member 4 (PARP4), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PARP4 (143)
Length:
5520
CDS:
16..5331

Additional Resources:

NCBI RefSeq record:
XM_011534931.1
NBCI Gene record:
PARP4 (143)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011534931.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000052926 GCTCAGTACAAGTATCAAGTA pLKO.1 1599 CDS 100% 4.950 6.930 N PARP4 n/a
2 TRCN0000298743 GCTCAGTACAAGTATCAAGTA pLKO_005 1599 CDS 100% 4.950 6.930 N PARP4 n/a
3 TRCN0000052924 CCTGGGACTATTGGCTAAGAA pLKO.1 1173 CDS 100% 5.625 4.500 N PARP4 n/a
4 TRCN0000298815 CCTGGGACTATTGGCTAAGAA pLKO_005 1173 CDS 100% 5.625 4.500 N PARP4 n/a
5 TRCN0000052925 GCACTAATTCAAGAGAAAGAA pLKO.1 3454 CDS 100% 5.625 3.938 N PARP4 n/a
6 TRCN0000298745 GCACTAATTCAAGAGAAAGAA pLKO_005 3454 CDS 100% 5.625 3.938 N PARP4 n/a
7 TRCN0000052927 CCTAAGCATATCACAAGCAAT pLKO.1 2938 CDS 100% 4.950 3.465 N PARP4 n/a
8 TRCN0000298742 CCTAAGCATATCACAAGCAAT pLKO_005 2938 CDS 100% 4.950 3.465 N PARP4 n/a
9 TRCN0000052923 GCATTCAATCTCTAGGTGTAA pLKO.1 4988 CDS 100% 4.950 3.465 N PARP4 n/a
10 TRCN0000298746 GCATTCAATCTCTAGGTGTAA pLKO_005 4988 CDS 100% 4.950 3.465 N PARP4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011534931.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.