Transcript: Human XM_011534938.2

PREDICTED: Homo sapiens beta 3-glucosyltransferase (B3GLCT), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
B3GLCT (145173)
Length:
4047
CDS:
96..1445

Additional Resources:

NCBI RefSeq record:
XM_011534938.2
NBCI Gene record:
B3GLCT (145173)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011534938.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427031 CTTAAGTATTCCACTTGTAAA pLKO_005 521 CDS 100% 13.200 18.480 N B3GLCT n/a
2 TRCN0000425132 GACTGTCTACAGTTCTATTTG pLKO_005 1829 3UTR 100% 13.200 18.480 N B3GLCT n/a
3 TRCN0000420314 ACTTCCGTTGTTACCGCATTT pLKO_005 278 CDS 100% 10.800 15.120 N B3GLCT n/a
4 TRCN0000035020 CGCCAGTAAATGTCGATGCTA pLKO.1 1169 CDS 100% 3.000 4.200 N B3GLCT n/a
5 TRCN0000424980 CCGACTTTACAATAGATTTAA pLKO_005 580 CDS 100% 15.000 12.000 N B3GLCT n/a
6 TRCN0000035019 CCAGTGAAGAAGAAGGATATT pLKO.1 735 CDS 100% 13.200 9.240 N B3GLCT n/a
7 TRCN0000414299 TTCTACTGTGCTACCACATTC pLKO_005 687 CDS 100% 10.800 7.560 N B3GLCT n/a
8 TRCN0000035022 CCAGAGTCAAAGTAATTCTTT pLKO.1 134 CDS 100% 5.625 3.938 N B3GLCT n/a
9 TRCN0000035021 GCCAGGCAAGTCTCATTGAAT pLKO.1 826 CDS 100% 5.625 3.938 N B3GLCT n/a
10 TRCN0000035023 GCATGGTTAGTCATTGTGGAT pLKO.1 975 CDS 100% 2.640 1.848 N B3GLCT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011534938.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.