Transcript: Human XM_011535670.2

PREDICTED: Homo sapiens MMS22 like, DNA repair protein (MMS22L), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MMS22L (253714)
Length:
4831
CDS:
198..3983

Additional Resources:

NCBI RefSeq record:
XM_011535670.2
NBCI Gene record:
MMS22L (253714)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011535670.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416467 AGACTTGCTGTTGCGATAAAC pLKO_005 1585 CDS 100% 13.200 18.480 N MMS22L n/a
2 TRCN0000149685 GCTTGTATCCTTCCCATGAAA pLKO.1 2116 CDS 100% 5.625 7.875 N MMS22L n/a
3 TRCN0000127753 GTCACTCAACAGGTACGACAA pLKO.1 1004 CDS 100% 4.050 5.670 N MMS22L n/a
4 TRCN0000420480 TGACCCTTTACCAACTAATTT pLKO_005 377 CDS 100% 15.000 10.500 N MMS22L n/a
5 TRCN0000129669 CCTCAAGTTGTAGCAAGATAT pLKO.1 2538 CDS 100% 13.200 9.240 N MMS22L n/a
6 TRCN0000149282 GCACCTATGTTGTCAGCAATT pLKO.1 3159 CDS 100% 10.800 7.560 N MMS22L n/a
7 TRCN0000128663 CCAACTCTTCAAGGAAACTAA pLKO.1 3488 CDS 100% 5.625 3.938 N MMS22L n/a
8 TRCN0000130019 GCTTCATGGATTACTCTTGTA pLKO.1 716 CDS 100% 4.950 3.465 N MMS22L n/a
9 TRCN0000148277 CCAGTGTTAATATAGGAGCAT pLKO.1 760 CDS 100% 2.640 1.848 N MMS22L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011535670.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.