Transcript: Human XM_011535722.3

PREDICTED: Homo sapiens SNF2 histone linker PHD RING helicase (SHPRH), transcript variant X18, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SHPRH (257218)
Length:
2830
CDS:
162..2729

Additional Resources:

NCBI RefSeq record:
XM_011535722.3
NBCI Gene record:
SHPRH (257218)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011535722.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235922 ACGGAACCAGAAGCGCTATAT pLKO_005 2546 CDS 100% 13.200 18.480 N SHPRH n/a
2 TRCN0000015556 GCACTTCTTATGGCGAGAGAT pLKO.1 1154 CDS 100% 4.950 6.930 N SHPRH n/a
3 TRCN0000235918 GGTCTGAAACTCTACTATAAT pLKO_005 1188 CDS 100% 15.000 12.000 N SHPRH n/a
4 TRCN0000015553 CCAGCGTTTGAGTGGGATTAA pLKO.1 2766 3UTR 100% 13.200 9.240 N SHPRH n/a
5 TRCN0000015555 CCAGGAGAAATCGCAGTAAAT pLKO.1 1867 CDS 100% 13.200 9.240 N SHPRH n/a
6 TRCN0000235921 GAAATCCAGAATATCGAATTT pLKO_005 1434 CDS 100% 13.200 9.240 N SHPRH n/a
7 TRCN0000235920 GATGATGATCCTTACTATTAT pLKO_005 1836 CDS 100% 15.000 9.000 N SHPRH n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011535722.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.