Transcript: Human XM_011535921.2

PREDICTED: Homo sapiens sine oculis binding protein homolog (SOBP), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SOBP (55084)
Length:
5914
CDS:
151..2811

Additional Resources:

NCBI RefSeq record:
XM_011535921.2
NBCI Gene record:
SOBP (55084)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011535921.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000417462 ACCCGAGGACAGTGTTATTTC pLKO_005 297 CDS 100% 13.200 18.480 N SOBP n/a
2 TRCN0000219768 TCATGGCAGTGTGCCCATTAT pLKO.1 396 CDS 100% 13.200 10.560 N SOBP n/a
3 TRCN0000432434 TGGAATATCCCGCTAACAGAT pLKO_005 1087 CDS 100% 4.950 3.960 N SOBP n/a
4 TRCN0000414963 TGGTGTAAGCACATAAGACAC pLKO_005 868 CDS 100% 4.050 3.240 N SOBP n/a
5 TRCN0000219767 GCTATGATAAGGTTGAATTAA pLKO.1 176 CDS 100% 15.000 10.500 N SOBP n/a
6 TRCN0000167050 CCTGTCATGGTTAAGAGAAAT pLKO.1 3897 3UTR 100% 13.200 9.240 N SOBP n/a
7 TRCN0000219553 TGCCAAGAGAACTCGGTAAAT pLKO.1 3562 3UTR 100% 13.200 9.240 N Sobp n/a
8 TRCN0000219551 TGGCTGGTATGGCTATGATAA pLKO.1 165 CDS 100% 13.200 9.240 N Sobp n/a
9 TRCN0000434130 ACAAGGACCAATGTAGGTATT pLKO_005 3124 3UTR 100% 10.800 7.560 N SOBP n/a
10 TRCN0000425181 AGTGGGAATCAAGCGCTATTC pLKO_005 657 CDS 100% 10.800 7.560 N SOBP n/a
11 TRCN0000428658 CAATATAAGCACAGGCTATTC pLKO_005 324 CDS 100% 10.800 7.560 N SOBP n/a
12 TRCN0000172427 CAGTGAGCATGATGCCAAATG pLKO.1 1664 CDS 100% 10.800 7.560 N SOBP n/a
13 TRCN0000172730 GAGGTGCCTCCGAATTAGAAA pLKO.1 2778 CDS 100% 5.625 3.938 N SOBP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011535921.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.