Transcript: Human XM_011535959.3

PREDICTED: Homo sapiens decaprenyl diphosphate synthase subunit 2 (PDSS2), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PDSS2 (57107)
Length:
3341
CDS:
214..1281

Additional Resources:

NCBI RefSeq record:
XM_011535959.3
NBCI Gene record:
PDSS2 (57107)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011535959.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000154256 CGTGAACACTTCATGTCAGAA pLKO.1 594 CDS 100% 4.950 6.930 N PDSS2 n/a
2 TRCN0000153847 CCTCTTATTCTGCGTTAGCAT pLKO.1 3183 3UTR 100% 3.000 4.200 N PDSS2 n/a
3 TRCN0000152602 GCTCTTATGGACTTGGTACAA pLKO.1 865 CDS 100% 4.950 3.960 N PDSS2 n/a
4 TRCN0000157157 GCAGAGATCACGGAGCTAATT pLKO.1 658 CDS 100% 13.200 9.240 N PDSS2 n/a
5 TRCN0000253055 GGAGACTTTCTTCTAGCAAAT pLKO_005 787 CDS 100% 10.800 7.560 N Pdss2 n/a
6 TRCN0000156980 CCTCAGCAAATGGACAGGAAA pLKO.1 1550 3UTR 100% 4.950 3.465 N PDSS2 n/a
7 TRCN0000157991 CCTGTGTCGTTACCATGGAAA pLKO.1 1170 CDS 100% 4.950 3.465 N PDSS2 n/a
8 TRCN0000150551 GAACACTTCATGTCAGAACTA pLKO.1 597 CDS 100% 4.950 3.465 N PDSS2 n/a
9 TRCN0000156683 GCTATCCTGAGTGGAGACTTT pLKO.1 775 CDS 100% 4.950 3.465 N PDSS2 n/a
10 TRCN0000154056 CCACCATAATTTGAGGCCTAT pLKO.1 2924 3UTR 100% 4.050 2.835 N PDSS2 n/a
11 TRCN0000151032 GCAATGGAATTAGCAAAGCAT pLKO.1 1009 CDS 100% 3.000 1.800 N PDSS2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011535959.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.