Transcript: Human XM_011536281.3

PREDICTED: Homo sapiens FIG4 phosphoinositide 5-phosphatase (FIG4), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FIG4 (9896)
Length:
3638
CDS:
812..3472

Additional Resources:

NCBI RefSeq record:
XM_011536281.3
NBCI Gene record:
FIG4 (9896)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011536281.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000303454 AGCTAGGTATCTACGAATATT pLKO_005 1189 CDS 100% 15.000 21.000 N FIG4 n/a
2 TRCN0000113784 CGACCAGTGTATGTCACTCTA pLKO.1 1541 CDS 100% 4.950 6.930 N FIG4 n/a
3 TRCN0000113783 CCGATAGACAAGATTCCATTA pLKO.1 2502 CDS 100% 10.800 8.640 N FIG4 n/a
4 TRCN0000299148 CCGATAGACAAGATTCCATTA pLKO_005 2502 CDS 100% 10.800 8.640 N FIG4 n/a
5 TRCN0000303453 AGGTTCTTAGAAGGCTATTAT pLKO_005 1046 CDS 100% 15.000 10.500 N FIG4 n/a
6 TRCN0000113782 CCAGTGTATGTCACTCTAATA pLKO.1 1544 CDS 100% 13.200 9.240 N FIG4 n/a
7 TRCN0000299199 CCAGTGTATGTCACTCTAATA pLKO_005 1544 CDS 100% 13.200 9.240 N FIG4 n/a
8 TRCN0000113781 GAACCTGTCTTGTCTCATCTT pLKO.1 3515 3UTR 100% 4.950 3.465 N FIG4 n/a
9 TRCN0000299149 GAACCTGTCTTGTCTCATCTT pLKO_005 3515 3UTR 100% 4.950 3.465 N FIG4 n/a
10 TRCN0000113785 GCAATCTATAAGGTCGAAGAT pLKO.1 1115 CDS 100% 4.950 3.465 N FIG4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011536281.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.