Transcript: Human XM_011536342.3

PREDICTED: Homo sapiens gephyrin (GPHN), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GPHN (10243)
Length:
3822
CDS:
517..2955

Additional Resources:

NCBI RefSeq record:
XM_011536342.3
NBCI Gene record:
GPHN (10243)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011536342.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000364523 CCCATCGGCCATGACATTAAA pLKO_005 2119 CDS 100% 15.000 21.000 N GPHN n/a
2 TRCN0000119043 CCCACGATCAACTTGGGTATT pLKO.1 2362 CDS 100% 10.800 15.120 N GPHN n/a
3 TRCN0000119045 GAGTCCTTACAGTGAGTGATA pLKO.1 569 CDS 100% 4.950 6.930 N GPHN n/a
4 TRCN0000098587 GCATACAAGATAGTACCAGAT pLKO.1 679 CDS 100% 4.050 5.670 N Gphn n/a
5 TRCN0000119044 GCCAATGGATTGTTGATGCTA pLKO.1 2860 CDS 100% 3.000 4.200 N GPHN n/a
6 TRCN0000119046 CCAGAATACCATCGGTGTATA pLKO.1 2755 CDS 100% 13.200 10.560 N GPHN n/a
7 TRCN0000369145 CAGTCACAGTGCTGTCGATAT pLKO_005 1650 CDS 100% 10.800 8.640 N GPHN n/a
8 TRCN0000364524 ATAGTTCCTCATCACATATAA pLKO_005 1202 CDS 100% 15.000 10.500 N GPHN n/a
9 TRCN0000313416 GAAGACCGCAGTGGGATAAAT pLKO_005 610 CDS 100% 15.000 10.500 N Gphn n/a
10 TRCN0000364532 GAAGACCGCAGTGGGATAAAT pLKO_005 610 CDS 100% 15.000 10.500 N GPHN n/a
11 TRCN0000369147 GTCAACATCTTGAACTATATT pLKO_005 3068 3UTR 100% 15.000 10.500 N GPHN n/a
12 TRCN0000364516 AGTGGAAGATACCGAACTTAT pLKO_005 2022 CDS 100% 13.200 9.240 N GPHN n/a
13 TRCN0000119042 CCTTCTTAGTATGCTTCATAA pLKO.1 3358 3UTR 100% 13.200 9.240 N GPHN n/a
14 TRCN0000364460 TCTCATGTATCTCGTGTTTAT pLKO_005 3409 3UTR 100% 13.200 9.240 N GPHN n/a
15 TRCN0000369146 CATCATCAAAGCAAGGTTATC pLKO_005 2709 CDS 100% 10.800 7.560 N GPHN n/a
16 TRCN0000098585 CCCTTCTTAGTATGCTTCATA pLKO.1 3357 3UTR 100% 5.625 3.938 N Gphn n/a
17 TRCN0000312312 CCCTTCTTAGTATGCTTCATA pLKO_005 3357 3UTR 100% 5.625 3.938 N Gphn n/a
18 TRCN0000098589 GCAAGAAAGGATCTCAGGAAT pLKO.1 956 CDS 100% 4.950 3.465 N Gphn n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011536342.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.