Transcript: Human XM_011536371.3

PREDICTED: Homo sapiens adaptor related protein complex 4 subunit sigma 1 (AP4S1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
AP4S1 (11154)
Length:
2474
CDS:
404..883

Additional Resources:

NCBI RefSeq record:
XM_011536371.3
NBCI Gene record:
AP4S1 (11154)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011536371.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000381226 TTTATAAGGTCCCTAGATATC pLKO_005 1229 3UTR 100% 10.800 15.120 N AP4S1 n/a
2 TRCN0000380894 TTTCCACAGTACTTGGCAAAT pLKO_005 730 CDS 100% 10.800 15.120 N AP4S1 n/a
3 TRCN0000059843 CGAGTGAGTGAATTAGATGTA pLKO.1 692 CDS 100% 4.950 6.930 N AP4S1 n/a
4 TRCN0000381990 ATGAGTATTTCAGCCGAGTGA pLKO_005 678 CDS 100% 2.640 3.696 N AP4S1 n/a
5 TRCN0000381699 ACCAATGAACAGCACAGTATG pLKO_005 900 3UTR 100% 10.800 7.560 N AP4S1 n/a
6 TRCN0000379452 CAAATGCACTCTGGTCCTTAT pLKO_005 746 CDS 100% 10.800 7.560 N AP4S1 n/a
7 TRCN0000379984 TCTCCAGACAGTTCATCATTC pLKO_005 830 CDS 100% 10.800 7.560 N AP4S1 n/a
8 TRCN0000059847 CCAGACAGTTCATCATTCAAA pLKO.1 833 CDS 100% 5.625 3.938 N AP4S1 n/a
9 TRCN0000059846 CGACTTTCTAAGTACTATGAA pLKO.1 446 CDS 100% 5.625 3.938 N AP4S1 n/a
10 TRCN0000059845 GCAAATGCACTCTGGTCCTTA pLKO.1 745 CDS 100% 4.950 3.465 N AP4S1 n/a
11 TRCN0000059844 CGAGATGGCTATTTATGAATT pLKO.1 631 CDS 100% 0.000 0.000 N AP4S1 n/a
12 TRCN0000379910 AGTGAGTGAATTAGATGTATC pLKO_005 694 CDS 100% 10.800 6.480 N AP4S1 n/a
13 TRCN0000113121 GCCGAGTGAGTGAATTAGATA pLKO.1 690 CDS 100% 5.625 4.500 N Ap4s1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011536371.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.