Transcript: Human XM_011536374.1

PREDICTED: Homo sapiens bromodomain adjacent to zinc finger domain 1A (BAZ1A), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BAZ1A (11177)
Length:
5315
CDS:
147..4538

Additional Resources:

NCBI RefSeq record:
XM_011536374.1
NBCI Gene record:
BAZ1A (11177)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011536374.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000218802 GAAATTCAACGGCAGATATAT pLKO_005 1951 CDS 100% 15.000 21.000 N BAZ1A n/a
2 TRCN0000229786 CGTAGCGTGATATGGTCTAAA pLKO_005 3279 CDS 100% 13.200 18.480 N BAZ1A n/a
3 TRCN0000218199 ATTGGATACAGTACTGGTTTA pLKO_005 4752 3UTR 100% 10.800 15.120 N BAZ1A n/a
4 TRCN0000034282 CGACCGCATGTATAGACGATA pLKO.1 2288 CDS 100% 4.950 6.930 N BAZ1A n/a
5 TRCN0000229784 TGCAATTGATCCCTTACTATT pLKO_005 416 CDS 100% 13.200 10.560 N BAZ1A n/a
6 TRCN0000368658 AGCAGGAGTTCCGGGAATTAA pLKO_005 1801 CDS 100% 15.000 10.500 N BAZ1A n/a
7 TRCN0000359143 TCATCTCTTTCAACGTATAAA pLKO_005 597 CDS 100% 15.000 10.500 N BAZ1A n/a
8 TRCN0000359204 CAAGGTTACAGATCGACATAT pLKO_005 2861 CDS 100% 13.200 9.240 N BAZ1A n/a
9 TRCN0000229785 CTGATAGCAAACCAACATATA pLKO_005 2713 CDS 100% 13.200 9.240 N BAZ1A n/a
10 TRCN0000034281 CCCAGTAATGTGGACCAAGTT pLKO.1 4482 CDS 100% 4.950 3.465 N BAZ1A n/a
11 TRCN0000034279 GCGATGAAGAAGAAGGTCAAA pLKO.1 3559 CDS 100% 4.950 3.465 N BAZ1A n/a
12 TRCN0000034283 GCCAACAACAAGAACCTGGAA pLKO.1 3724 CDS 100% 2.640 1.848 N BAZ1A n/a
13 TRCN0000034280 CCCTAGTTTCAACTAGGGATT pLKO.1 1744 CDS 100% 0.405 0.284 N BAZ1A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011536374.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.