Transcript: Human XM_011536436.2

PREDICTED: Homo sapiens solute carrier family 24 member 4 (SLC24A4), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC24A4 (123041)
Length:
9968
CDS:
106..2115

Additional Resources:

NCBI RefSeq record:
XM_011536436.2
NBCI Gene record:
SLC24A4 (123041)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011536436.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000436594 ATGTGCCGGGAAGACGATTAG pLKO_005 2095 CDS 100% 10.800 15.120 N SLC24A4 n/a
2 TRCN0000043850 CGTCTTTACCTTCGTCAACTT pLKO.1 2070 CDS 100% 4.950 6.930 N SLC24A4 n/a
3 TRCN0000415589 TCTCCATAATGATAGAGTTTA pLKO_005 2048 CDS 100% 13.200 9.240 N SLC24A4 n/a
4 TRCN0000043851 CAGAGCTGTTTGCGTCTGTTA pLKO.1 701 CDS 100% 4.950 3.465 N SLC24A4 n/a
5 TRCN0000043848 CGCTGTGTTCTCCTACATCAT pLKO.1 1638 CDS 100% 4.950 3.465 N SLC24A4 n/a
6 TRCN0000043849 GCTCATCATCTTGTATGTGTT pLKO.1 945 CDS 100% 4.950 3.465 N SLC24A4 n/a
7 TRCN0000043852 GAGAACATTGAGAACGGGAAT pLKO.1 1360 CDS 100% 4.050 2.835 N SLC24A4 n/a
8 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 7205 3UTR 100% 4.950 2.475 Y LOC387873 n/a
9 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 5545 3UTR 100% 5.625 2.813 Y KLHL30 n/a
10 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 5545 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011536436.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.