Transcript: Human XM_011536574.1

PREDICTED: Homo sapiens spectrin repeat containing nuclear envelope protein 2 (SYNE2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SYNE2 (23224)
Length:
21948
CDS:
231..21041

Additional Resources:

NCBI RefSeq record:
XM_011536574.1
NBCI Gene record:
SYNE2 (23224)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011536574.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000303800 ATTGAACGAGAGGCAATTATT pLKO_005 10662 CDS 100% 15.000 21.000 N SYNE2 n/a
2 TRCN0000303799 CATCGACGATCTCCATATTTC pLKO_005 281 CDS 100% 13.200 18.480 N SYNE2 n/a
3 TRCN0000303801 GATGGAAACAATCAATCATAT pLKO_005 21475 3UTR 100% 13.200 9.240 N SYNE2 n/a
4 TRCN0000061605 CGGACATTAGTATTGAAGAAA pLKO.1 18061 CDS 100% 5.625 3.938 N SYNE2 n/a
5 TRCN0000061603 GCAGTGAAATACCTCTTGAAT pLKO.1 5356 CDS 100% 5.625 3.938 N SYNE2 n/a
6 TRCN0000061604 CCTCAGTTATATCCGACCTAT pLKO.1 382 CDS 100% 4.950 3.465 N SYNE2 n/a
7 TRCN0000300081 CCTCAGTTATATCCGACCTAT pLKO_005 382 CDS 100% 4.950 3.465 N SYNE2 n/a
8 TRCN0000061606 GCCACCTATGAGTCTGTCAAT pLKO.1 816 CDS 100% 4.950 3.465 N SYNE2 n/a
9 TRCN0000061607 GCGCTATGAAAGAACGGAGTT pLKO.1 15629 CDS 100% 4.050 2.835 N SYNE2 n/a
10 TRCN0000310545 GCGCTATGAAAGAACGGAGTT pLKO_005 15629 CDS 100% 4.050 2.835 N SYNE2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011536574.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11699 pDONR223 100% 3.9% 3.8% None (many diffs) n/a
2 ccsbBroad304_11699 pLX_304 0% 3.9% 3.8% V5 (many diffs) n/a
Download CSV