Transcript: Human XM_011537170.2

PREDICTED: Homo sapiens basal body orientation factor 1 (BBOF1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BBOF1 (80127)
Length:
3021
CDS:
130..1935

Additional Resources:

NCBI RefSeq record:
XM_011537170.2
NBCI Gene record:
BBOF1 (80127)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011537170.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263912 TTGCAAGAGAGTCATACTTTA pLKO_005 886 CDS 100% 13.200 10.560 N BBOF1 n/a
2 TRCN0000263915 ACAAGCTGCTTTCAATTTAAA pLKO_005 1392 CDS 100% 15.000 10.500 N BBOF1 n/a
3 TRCN0000263913 TAGGATTAAGTATCGTGATAC pLKO_005 276 CDS 100% 10.800 7.560 N BBOF1 n/a
4 TRCN0000263916 TGCAGCAACACGCAATGATAG pLKO_005 1175 CDS 100% 10.800 7.560 N BBOF1 n/a
5 TRCN0000172809 GCAGATAGCACAAGCTGCTTT pLKO.1 1383 CDS 100% 4.950 3.465 N BBOF1 n/a
6 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 2698 3UTR 100% 4.950 2.475 Y ORAI2 n/a
7 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 2622 3UTR 100% 4.950 2.475 Y ERAP2 n/a
8 TRCN0000138140 GATTGAGACCATCCTGGCTAA pLKO.1 2677 3UTR 100% 4.050 2.025 Y LOC441087 n/a
9 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2623 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011537170.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.