Transcript: Human XM_011537266.3

PREDICTED: Homo sapiens actinin alpha 1 (ACTN1), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ACTN1 (87)
Length:
3521
CDS:
16..2790

Additional Resources:

NCBI RefSeq record:
XM_011537266.3
NBCI Gene record:
ACTN1 (87)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011537266.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000330524 ACGGCGAGAGTGACCTCTAAT pLKO_005 2771 CDS 100% 13.200 18.480 N ACTN1 n/a
2 TRCN0000055825 CCAGACCTACCACGTCAATAT pLKO.1 1863 CDS 100% 13.200 18.480 N ACTN1 n/a
3 TRCN0000353679 TCCAGACCTACCACGTCAATA pLKO_005 1862 CDS 100% 13.200 18.480 N ACTN1 n/a
4 TRCN0000330526 ATTAACTATTTGCACCGAAAT pLKO_005 3068 3UTR 100% 10.800 15.120 N ACTN1 n/a
5 TRCN0000330525 CTCAATGAGCTGGACTATTAT pLKO_005 1507 CDS 100% 15.000 10.500 N ACTN1 n/a
6 TRCN0000330527 TCACGCCTCAGGAGATCAATG pLKO_005 1910 CDS 100% 10.800 7.560 N ACTN1 n/a
7 TRCN0000055823 CCTCAGGAGATCAATGGCAAA pLKO.1 1915 CDS 100% 4.050 2.835 N ACTN1 n/a
8 TRCN0000055824 CGAAGAAATCGTGGATGGGAA pLKO.1 438 CDS 100% 2.640 1.848 N ACTN1 n/a
9 TRCN0000055827 GCATCGTCAACTACAAGCCAA pLKO.1 2156 CDS 100% 2.640 1.848 N ACTN1 n/a
10 TRCN0000055826 CCATCATGACTTACGTGTCTA pLKO.1 812 CDS 100% 4.950 2.475 Y ACTN1 n/a
11 TRCN0000054660 GCGACAGAAGGACTATGAGTT pLKO.1 1377 CDS 100% 4.950 3.465 N Nfe2l2 n/a
12 TRCN0000090217 CCTTCATTGACTTCATGTCAA pLKO.1 2543 CDS 100% 0.495 0.297 N Actn4 n/a
13 TRCN0000309799 CCTTCATTGACTTCATGTCAA pLKO_005 2543 CDS 100% 0.495 0.297 N Actn4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011537266.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.