Transcript: Human XM_011537334.1

PREDICTED: Homo sapiens exocyst complex component 3 like 4 (EXOC3L4), transcript variant X11, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EXOC3L4 (91828)
Length:
2942
CDS:
972..2603

Additional Resources:

NCBI RefSeq record:
XM_011537334.1
NBCI Gene record:
EXOC3L4 (91828)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011537334.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000283744 CTGATCACCTGCGTCTAGTTC pLKO_005 2586 CDS 100% 4.950 6.930 N EXOC3L4 n/a
2 TRCN0000283743 TATGGACGTGTGCCTGCTTTA pLKO_005 971 5UTR 100% 10.800 8.640 N EXOC3L4 n/a
3 TRCN0000268656 GACACTGCAGTTAGGGAATTT pLKO_005 2706 3UTR 100% 13.200 9.240 N EXOC3L4 n/a
4 TRCN0000268608 CAGCGTCTGAGGAACTGAAAC pLKO_005 61 5UTR 100% 10.800 7.560 N EXOC3L4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011537334.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_16064 pDONR223 0% 75% 74.9% None (many diffs) n/a
2 ccsbBroad304_16064 pLX_304 0% 75% 74.9% V5 (many diffs) n/a
3 TRCN0000479259 CCCCTACTTTCGTTTCAAAGTTAC pLX_317 10.1% 75% 74.9% V5 (many diffs) n/a
4 ccsbBroadEn_15216 pDONR223 98.1% 74.9% 74.6% None (many diffs) n/a
5 ccsbBroad304_15216 pLX_304 0% 74.9% 74.6% V5 (many diffs) n/a
6 TRCN0000478423 ACTTGGATTACCTTAAGGATGCAC pLX_317 14.8% 74.9% 74.6% V5 (many diffs) n/a
Download CSV