Transcript: Human XM_011537471.2

PREDICTED: Homo sapiens sperm acrosome associated 7 (SPACA7), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SPACA7 (122258)
Length:
1083
CDS:
341..943

Additional Resources:

NCBI RefSeq record:
XM_011537471.2
NBCI Gene record:
SPACA7 (122258)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011537471.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000137530 CAAATCTCCATGGCGATCCTT pLKO.1 570 CDS 100% 3.000 4.200 N SPACA7 n/a
2 TRCN0000136162 GCGATCCTTCTGAGAATTATC pLKO.1 582 CDS 100% 13.200 10.560 N SPACA7 n/a
3 TRCN0000137603 CTGGCAGTGAGAAGAGTGTTT pLKO.1 621 CDS 100% 4.950 3.465 N SPACA7 n/a
4 TRCN0000135752 CCAATGATGAAGCCAATGCTA pLKO.1 546 CDS 100% 3.000 2.100 N SPACA7 n/a
5 TRCN0000138325 CAACACCGTTACATGCTGGTA pLKO.1 435 CDS 100% 2.640 1.848 N SPACA7 n/a
6 TRCN0000138743 CTGTTGGCAAGAAACTGAGCT pLKO.1 95 5UTR 100% 2.640 1.848 N SPACA7 n/a
7 TRCN0000138105 GCGAAATGCCAAGTACAGCAT pLKO.1 405 CDS 100% 2.640 1.848 N SPACA7 n/a
8 TRCN0000136278 GAGAATTATCAAGCTGGTGGT pLKO.1 461 CDS 100% 2.160 1.512 N SPACA7 n/a
9 TRCN0000135024 CCTACTGAAATACCATTCAGT pLKO.1 305 5UTR 100% 0.300 0.210 N SPACA7 n/a
10 TRCN0000135890 GCCAAGTACAGCATCAACATT pLKO.1 412 CDS 100% 5.625 3.375 N SPACA7 n/a
11 TRCN0000134073 GTTCACCTACTGAAATACCAT pLKO.1 300 5UTR 100% 3.000 1.800 N SPACA7 n/a
12 TRCN0000134384 GAAGAGTGTTTCCAGTAAAGA pLKO.1 631 CDS 100% 5.625 3.938 N SPACA7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011537471.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.