Transcript: Human XM_011537909.2

PREDICTED: Homo sapiens BTB domain containing 11 (BTBD11), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BTBD11 (121551)
Length:
4683
CDS:
486..2759

Additional Resources:

NCBI RefSeq record:
XM_011537909.2
NBCI Gene record:
BTBD11 (121551)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011537909.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000216949 CGTGGATGTCACAATTGATAT pLKO.1 1865 CDS 100% 13.200 18.480 N Btbd11 n/a
2 TRCN0000241367 CGTGGATGTCACAATTGATAT pLKO_005 1865 CDS 100% 13.200 18.480 N Btbd11 n/a
3 TRCN0000136885 CCAGAGTCACTGCTCATTAAA pLKO.1 2397 CDS 100% 15.000 10.500 N BTBD11 n/a
4 TRCN0000421481 CTCTCATCCAGTGCTTGTTAA pLKO_005 1963 CDS 100% 13.200 9.240 N BTBD11 n/a
5 TRCN0000138705 GCAGCGACACTGTGAGATTAT pLKO.1 2474 CDS 100% 13.200 9.240 N BTBD11 n/a
6 TRCN0000435046 ACGTCAACCATGGTAGCAAAT pLKO_005 3167 3UTR 100% 10.800 7.560 N BTBD11 n/a
7 TRCN0000136747 GCATATTGCGAAGGCTACTTT pLKO.1 2574 CDS 100% 5.625 3.938 N BTBD11 n/a
8 TRCN0000137634 GCATTCAAGCAGCTCCTGTAT pLKO.1 2628 CDS 100% 4.950 3.465 N BTBD11 n/a
9 TRCN0000138448 CAAGGTTCAAAGCACTCCTCT pLKO.1 2281 CDS 100% 2.640 1.848 N BTBD11 n/a
10 TRCN0000136604 CAAGTTTCTTGGAGTCACAGA pLKO.1 2546 CDS 100% 2.640 1.848 N BTBD11 n/a
11 TRCN0000138291 CCATGCCAAGTTTCTTGGAGT pLKO.1 2540 CDS 100% 2.640 1.848 N BTBD11 n/a
12 TRCN0000138806 GACAAATGATGGCACCTGCAT pLKO.1 2312 CDS 100% 2.640 1.848 N BTBD11 n/a
13 TRCN0000137962 GAGATCATGGAGCTTCTGTCT pLKO.1 2424 CDS 100% 2.640 1.848 N BTBD11 n/a
14 TRCN0000136620 GTGCTGTTATTTACAGCCTCT pLKO.1 2259 CDS 100% 0.216 0.151 N BTBD11 n/a
15 TRCN0000425314 AGGAAATAATCTGGCAAATTT pLKO_005 3211 3UTR 100% 15.000 9.000 N BTBD11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011537909.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.