Transcript: Human XM_011537957.2

PREDICTED: Homo sapiens glycosyltransferase 1 domain containing 1 (GLT1D1), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GLT1D1 (144423)
Length:
2909
CDS:
75..1037

Additional Resources:

NCBI RefSeq record:
XM_011537957.2
NBCI Gene record:
GLT1D1 (144423)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011537957.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244006 GGATTTAGAAGTACCGGTATT pLKO_005 782 CDS 100% 10.800 15.120 N GLT1D1 n/a
2 TRCN0000257200 TGGTTAGTGATCCTGCATTAG pLKO_005 901 CDS 100% 10.800 15.120 N GLT1D1 n/a
3 TRCN0000244004 GTCGCTTTCACAGAGTCAATG pLKO_005 279 CDS 100% 10.800 8.640 N GLT1D1 n/a
4 TRCN0000244005 GTGGACAATAGAGGCTTATTT pLKO_005 1358 3UTR 100% 15.000 10.500 N GLT1D1 n/a
5 TRCN0000146929 CCTCCACTGAATACTGAAATT pLKO.1 2018 3UTR 100% 13.200 9.240 N GLT1D1 n/a
6 TRCN0000244007 ATACGTGAGAATGTATCATTC pLKO_005 950 CDS 100% 10.800 7.560 N GLT1D1 n/a
7 TRCN0000150003 CACAGAGTCAATGAAGGAAAT pLKO.1 287 CDS 100% 10.800 7.560 N GLT1D1 n/a
8 TRCN0000148269 GCCTCCATCATGTAATAGAAT pLKO.1 2418 3UTR 100% 5.625 3.938 N GLT1D1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011537957.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.