Transcript: Human XM_011538063.3

PREDICTED: Homo sapiens cut like homeobox 2 (CUX2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CUX2 (23316)
Length:
13571
CDS:
6847..11340

Additional Resources:

NCBI RefSeq record:
XM_011538063.3
NBCI Gene record:
CUX2 (23316)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011538063.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000021070 CTGAGTGTTTACAAGCAATTA pLKO.1 7282 CDS 100% 13.200 18.480 N CUX2 n/a
2 TRCN0000021073 AGGAGCTTAATTCCGTCGCTT pLKO.1 7079 CDS 100% 2.640 3.696 N CUX2 n/a
3 TRCN0000021072 CGGGTAATGATGGACTCCCAA pLKO.1 10886 CDS 100% 2.640 3.696 N CUX2 n/a
4 TRCN0000021071 GCCTACCTGAAACGTCGCTAT pLKO.1 10264 CDS 100% 4.050 3.240 N CUX2 n/a
5 TRCN0000021069 CCTGAAGACTCACTGCTTATT pLKO.1 8050 CDS 100% 13.200 7.920 N CUX2 n/a
6 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 3714 5UTR 100% 4.050 2.025 Y P3H4 n/a
7 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 3714 5UTR 100% 4.050 2.025 Y ORAI2 n/a
8 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 3714 5UTR 100% 4.050 2.025 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011538063.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.