Transcript: Human XM_011538399.1

PREDICTED: Homo sapiens CCR4-NOT transcription complex subunit 2 (CNOT2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CNOT2 (4848)
Length:
3238
CDS:
538..2160

Additional Resources:

NCBI RefSeq record:
XM_011538399.1
NBCI Gene record:
CNOT2 (4848)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011538399.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000234898 ATGAATGGAGGAGACGTATTA pLKO_005 1885 CDS 100% 13.200 18.480 N CNOT2 n/a
2 TRCN0000015128 CCTCAGTTAAATCGCAGCTTA pLKO.1 817 CDS 100% 4.950 6.930 N CNOT2 n/a
3 TRCN0000015131 CCGTGATTGGAGATACCACAA pLKO.1 1935 CDS 100% 4.050 5.670 N CNOT2 n/a
4 TRCN0000233435 GTGAAGATCCTTCTCGTATTT pLKO_005 2597 3UTR 100% 13.200 10.560 N Cnot2 n/a
5 TRCN0000234899 GTGAAGATCCTTCTCGTATTT pLKO_005 2597 3UTR 100% 13.200 10.560 N CNOT2 n/a
6 TRCN0000103580 GCATTGTTCATTGTAGCACTA pLKO.1 2540 3UTR 100% 4.050 3.240 N Cnot2 n/a
7 TRCN0000015130 GCTCCTTATGTTGGAATGGTA pLKO.1 1303 CDS 100% 3.000 2.400 N CNOT2 n/a
8 TRCN0000234896 TTACCAGGCTCCAGCTATAAA pLKO_005 1384 CDS 100% 15.000 10.500 N CNOT2 n/a
9 TRCN0000233432 ACTCCTTATCAAGTAACATTT pLKO_005 1154 CDS 100% 13.200 9.240 N Cnot2 n/a
10 TRCN0000234895 ACTCCTTATCAAGTAACATTT pLKO_005 1154 CDS 100% 13.200 9.240 N CNOT2 n/a
11 TRCN0000234897 ATGTTCCATCTGAGTACTTAA pLKO_005 1784 CDS 100% 13.200 9.240 N CNOT2 n/a
12 TRCN0000015132 CAGGTGACAAACAGCATGTTT pLKO.1 583 CDS 100% 5.625 3.938 N CNOT2 n/a
13 TRCN0000015129 CGGGTTACTAACATTCCTCAA pLKO.1 1561 CDS 100% 4.050 2.835 N CNOT2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011538399.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.