Transcript: Human XM_011538402.3

PREDICTED: Homo sapiens ATPase sarcoplasmic/endoplasmic reticulum Ca2+ transporting 2 (ATP2A2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ATP2A2 (488)
Length:
5158
CDS:
7..3006

Additional Resources:

NCBI RefSeq record:
XM_011538402.3
NBCI Gene record:
ATP2A2 (488)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011538402.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000038530 CCTGGTGATATTGTAGAAATT pLKO.1 445 CDS 100% 13.200 18.480 N ATP2A2 n/a
2 TRCN0000300234 CCTGGTGATATTGTAGAAATT pLKO_005 445 CDS 100% 13.200 18.480 N ATP2A2 n/a
3 TRCN0000038529 GCGGGCAATCTACAACAACAT pLKO.1 2253 CDS 100% 4.950 6.930 N ATP2A2 n/a
4 TRCN0000310581 GCGGGCAATCTACAACAACAT pLKO_005 2253 CDS 100% 4.950 6.930 N ATP2A2 n/a
5 TRCN0000038532 CGCTCTCTGTTCTAGTAACTA pLKO.1 2702 CDS 100% 5.625 3.938 N ATP2A2 n/a
6 TRCN0000310577 CGCTCTCTGTTCTAGTAACTA pLKO_005 2702 CDS 100% 5.625 3.938 N ATP2A2 n/a
7 TRCN0000038533 CCATCAAATCTACCACACTAA pLKO.1 506 CDS 100% 4.950 3.465 N ATP2A2 n/a
8 TRCN0000300233 CCATCAAATCTACCACACTAA pLKO_005 506 CDS 100% 4.950 3.465 N ATP2A2 n/a
9 TRCN0000038531 CCCTTGGTTGTACTTCTGTTA pLKO.1 1028 CDS 100% 4.950 3.465 N ATP2A2 n/a
10 TRCN0000310582 CCCTTGGTTGTACTTCTGTTA pLKO_005 1028 CDS 100% 4.950 3.465 N ATP2A2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011538402.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.