Transcript: Human XM_011538815.2

PREDICTED: Homo sapiens early endosome antigen 1 (EEA1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EEA1 (8411)
Length:
7820
CDS:
221..4318

Additional Resources:

NCBI RefSeq record:
XM_011538815.2
NBCI Gene record:
EEA1 (8411)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011538815.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432278 ACGTCTGACAGAAGAATTAAA pLKO_005 664 CDS 100% 15.000 21.000 N EEA1 n/a
2 TRCN0000381251 CAATTGCAGGAGCGATGTAAA pLKO_005 3371 CDS 100% 13.200 18.480 N EEA1 n/a
3 TRCN0000029335 CCGCTATATTAGACTTGGAAA pLKO.1 2736 CDS 100% 4.950 6.930 N EEA1 n/a
4 TRCN0000029337 CCCTTGAAAGTATCAAGCAAA pLKO.1 2463 CDS 100% 0.495 0.396 N EEA1 n/a
5 TRCN0000256425 TTCATCAGCAACTCCTATAAA pLKO_005 145 5UTR 100% 15.000 10.500 N Eea1 n/a
6 TRCN0000381204 TTCATCAGCAACTCCTATAAA pLKO_005 145 5UTR 100% 15.000 10.500 N EEA1 n/a
7 TRCN0000381876 AGCATCTAAAGGCGGAGTTTA pLKO_005 1248 CDS 100% 13.200 9.240 N EEA1 n/a
8 TRCN0000381857 AGCCACCAGGCAAGATCTTAA pLKO_005 3211 CDS 100% 13.200 9.240 N EEA1 n/a
9 TRCN0000029338 CCATGCAGATTACAGCATTAA pLKO.1 3801 CDS 100% 13.200 9.240 N EEA1 n/a
10 TRCN0000379440 GACCAAATAGGAATTAGTATA pLKO_005 4428 3UTR 100% 13.200 9.240 N EEA1 n/a
11 TRCN0000029334 GCTTACTTCTTTCTCCTAAAT pLKO.1 4664 3UTR 100% 13.200 9.240 N EEA1 n/a
12 TRCN0000419182 GTTTGGACACTGGTTGCAATA pLKO_005 4404 3UTR 100% 10.800 7.560 N EEA1 n/a
13 TRCN0000029336 GCGGAGTTTAAGCAGCTACAA pLKO.1 1259 CDS 100% 4.950 3.465 N EEA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011538815.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.