Transcript: Human XM_011538984.2

PREDICTED: Homo sapiens SR-related CTD associated factor 11 (SCAF11), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SCAF11 (9169)
Length:
9115
CDS:
1759..6198

Additional Resources:

NCBI RefSeq record:
XM_011538984.2
NBCI Gene record:
SCAF11 (9169)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011538984.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000083247 CCATCTGTAAATGCTGATCTT pLKO.1 4009 CDS 100% 4.950 3.960 N SCAF11 n/a
2 TRCN0000300856 CCATCTGTAAATGCTGATCTT pLKO_005 4009 CDS 100% 4.950 3.960 N SCAF11 n/a
3 TRCN0000083246 CATCTGTAAATGCTGATCTTA pLKO.1 4010 CDS 100% 5.625 3.938 N SCAF11 n/a
4 TRCN0000083245 GCCTGATCCAAGAACCAGAAA pLKO.1 4899 CDS 100% 4.950 3.465 N SCAF11 n/a
5 TRCN0000300782 GCCTGATCCAAGAACCAGAAA pLKO_005 4899 CDS 100% 4.950 3.465 N SCAF11 n/a
6 TRCN0000083244 GCCTATGAATATCTTCCCATA pLKO.1 5478 CDS 100% 4.050 2.835 N SCAF11 n/a
7 TRCN0000300855 GCCTATGAATATCTTCCCATA pLKO_005 5478 CDS 100% 4.050 2.835 N SCAF11 n/a
8 TRCN0000083243 GCATTTATTCTGTCAGGTTAA pLKO.1 6567 3UTR 100% 10.800 6.480 N SCAF11 n/a
9 TRCN0000300781 GCATTTATTCTGTCAGGTTAA pLKO_005 6567 3UTR 100% 10.800 6.480 N SCAF11 n/a
10 TRCN0000140998 CCTGCTAACACAACATCCATT pLKO.1 995 5UTR 100% 4.950 2.475 Y TIGD1 n/a
11 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 6984 3UTR 100% 4.950 2.475 Y ERAP2 n/a
12 TRCN0000140699 GCCTGCTAACACAACATCCAT pLKO.1 994 5UTR 100% 3.000 1.500 Y TIGD1 n/a
13 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 6985 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011538984.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.