Transcript: Human XM_011539302.2

PREDICTED: Homo sapiens ADAM metallopeptidase with thrombospondin type 1 motif 14 (ADAMTS14), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ADAMTS14 (140766)
Length:
4440
CDS:
108..2852

Additional Resources:

NCBI RefSeq record:
XM_011539302.2
NBCI Gene record:
ADAMTS14 (140766)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011539302.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430560 GGGATCCAGTTCACCAAATAC pLKO_005 1776 CDS 100% 13.200 18.480 N ADAMTS14 n/a
2 TRCN0000427825 CCCTTATCGGGAGCAACAATG pLKO_005 1681 CDS 100% 10.800 15.120 N ADAMTS14 n/a
3 TRCN0000415803 GAAAGCCCTAATCGGAGATAC pLKO_005 3041 3UTR 100% 10.800 15.120 N ADAMTS14 n/a
4 TRCN0000087249 GCCTACAAGTACGTCATCCAT pLKO.1 1647 CDS 100% 3.000 4.200 N Adamts14 n/a
5 TRCN0000046707 CCTGGCCTACAAGTACGTCAT pLKO.1 1643 CDS 100% 4.050 2.835 N ADAMTS14 n/a
6 TRCN0000046704 CTGTGGAGGAAATCACCAGAA pLKO.1 2240 CDS 100% 4.050 2.835 N ADAMTS14 n/a
7 TRCN0000046706 TGCTTGGCATTCAGGACCTTT pLKO.1 657 CDS 100% 4.950 2.970 N ADAMTS14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011539302.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.