Transcript: Human XM_011539525.3

PREDICTED: Homo sapiens inositol polyphosphate-5-phosphatase F (INPP5F), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
INPP5F (22876)
Length:
6352
CDS:
540..3650

Additional Resources:

NCBI RefSeq record:
XM_011539525.3
NBCI Gene record:
INPP5F (22876)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011539525.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000380377 ACAGGTCACTTTGGGATATAA pLKO_005 3907 3UTR 100% 15.000 12.000 N INPP5F n/a
2 TRCN0000052876 CGCATTCAGTTGCATCTCAAA pLKO.1 3343 CDS 100% 4.950 3.960 N INPP5F n/a
3 TRCN0000303408 AGTCGGAACCTGAGTAGATTT pLKO_005 3781 3UTR 100% 13.200 9.240 N INPP5F n/a
4 TRCN0000052874 GCTCTGTAAGAAGCATCATTT pLKO.1 566 CDS 100% 13.200 9.240 N INPP5F n/a
5 TRCN0000307811 GCTCTGTAAGAAGCATCATTT pLKO_005 566 CDS 100% 13.200 9.240 N INPP5F n/a
6 TRCN0000052877 CGATTTCTAGTGGCTCTCATT pLKO.1 1074 CDS 100% 4.950 3.465 N INPP5F n/a
7 TRCN0000307794 CGATTTCTAGTGGCTCTCATT pLKO_005 1074 CDS 100% 4.950 3.465 N INPP5F n/a
8 TRCN0000052873 CGCAATTAGATGTCTCTCTTT pLKO.1 3286 CDS 100% 4.950 3.465 N INPP5F n/a
9 TRCN0000291895 CGCAATTAGATGTCTCTCTTT pLKO_005 3286 CDS 100% 4.950 3.465 N INPP5F n/a
10 TRCN0000052875 GCCTATTATGATGATGAAGTT pLKO.1 2205 CDS 100% 4.950 3.465 N INPP5F n/a
11 TRCN0000291896 GCCTATTATGATGATGAAGTT pLKO_005 2205 CDS 100% 4.950 3.465 N INPP5F n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011539525.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.