Transcript: Human XM_011539917.1

PREDICTED: Homo sapiens cartilage acidic protein 1 (CRTAC1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CRTAC1 (55118)
Length:
2199
CDS:
150..2030

Additional Resources:

NCBI RefSeq record:
XM_011539917.1
NBCI Gene record:
CRTAC1 (55118)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011539917.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000104836 CCCGTATGTGTCAACACCTAT pLKO.1 1872 CDS 100% 4.950 6.930 N Crtac1 n/a
2 TRCN0000055933 CGACAATGAGAATGGGCCTAA pLKO.1 923 CDS 100% 4.050 5.670 N CRTAC1 n/a
3 TRCN0000055935 CATTGCATGGACACCAATGAA pLKO.1 1815 CDS 100% 0.563 0.788 N CRTAC1 n/a
4 TRCN0000055936 CTCTATCTACATTGCCAATTA pLKO.1 722 CDS 100% 13.200 9.240 N CRTAC1 n/a
5 TRCN0000055937 CACCGACAAGTTGTTCAAGTT pLKO.1 584 CDS 100% 4.950 3.465 N CRTAC1 n/a
6 TRCN0000055934 GCAGTTACTGATGTGGACCAT pLKO.1 324 CDS 100% 2.640 1.848 N CRTAC1 n/a
7 TRCN0000372023 TACTTCCTCAACACCAATAAT pLKO_005 540 CDS 100% 15.000 9.000 N CRTAC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011539917.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12161 pDONR223 100% 61.9% 59.6% None (many diffs) n/a
2 ccsbBroad304_12161 pLX_304 0% 61.9% 59.6% V5 (many diffs) n/a
Download CSV