Transcript: Human XM_011539978.2

PREDICTED: Homo sapiens zinc finger MIZ-type containing 1 (ZMIZ1), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZMIZ1 (57178)
Length:
6878
CDS:
259..3108

Additional Resources:

NCBI RefSeq record:
XM_011539978.2
NBCI Gene record:
ZMIZ1 (57178)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011539978.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000017413 CCAGGCGTATAACAGCCAATT pLKO.1 873 CDS 100% 10.800 15.120 N ZMIZ1 n/a
2 TRCN0000017414 CCCTTCCTATTCAGAACATAA pLKO.1 1094 CDS 100% 13.200 10.560 N ZMIZ1 n/a
3 TRCN0000017415 GCCTGACATCAAGCCAAATAT pLKO.1 1527 CDS 100% 15.000 10.500 N ZMIZ1 n/a
4 TRCN0000414121 TACAAGCCAGAACAGTTTAAT pLKO_005 1312 CDS 100% 15.000 10.500 N ZMIZ1 n/a
5 TRCN0000433123 TGCCCATCAAGTCGGACTTAC pLKO_005 2378 CDS 100% 10.800 7.560 N ZMIZ1 n/a
6 TRCN0000017417 CCTCCTGTCTCTATTTGAGAA pLKO.1 3081 CDS 100% 4.950 3.465 N ZMIZ1 n/a
7 TRCN0000017416 GCCCAATGTCATGGAGATGAT pLKO.1 2469 CDS 100% 4.950 3.465 N ZMIZ1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011539978.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.