Transcript: Human XM_011540335.3

PREDICTED: Homo sapiens neuralized E3 ubiquitin protein ligase 1 (NEURL1), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NEURL1 (9148)
Length:
3470
CDS:
601..1473

Additional Resources:

NCBI RefSeq record:
XM_011540335.3
NBCI Gene record:
NEURL1 (9148)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011540335.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000221073 CTCGGCTGTTATGCTGTTCTT pLKO.1 1266 CDS 100% 4.950 6.930 N NEURL1 n/a
2 TRCN0000221077 GTTTGCCAATGAGGGCAACAT pLKO.1 1194 CDS 100% 0.495 0.693 N NEURL1 n/a
3 TRCN0000416227 TCGCATTCTGGGTGGACAAGA pLKO_005 1217 CDS 100% 4.950 3.465 N NEURL1 n/a
4 TRCN0000221076 CCGGTCCTCATCTACGAGCAA pLKO.1 1009 CDS 100% 0.880 0.616 N NEURL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011540335.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.