Transcript: Human XM_011540437.2

PREDICTED: Homo sapiens synaptotagmin-15 (LOC102724488), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LOC102724488 (102724488)
Length:
3673
CDS:
2197..3549

Additional Resources:

NCBI RefSeq record:
XM_011540437.2
NBCI Gene record:
LOC102724488 (102724488)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011540437.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000380085 TGTGGTTCTCGGTGGAATATG pLKO_005 2828 CDS 100% 13.200 6.600 Y SYT15 n/a
2 TRCN0000380616 CCATCAACCCTGTGTACAATG pLKO_005 3395 CDS 100% 10.800 5.400 Y SYT15 n/a
3 TRCN0000381499 GAGGCATTGTCAGTGTGTTTG pLKO_005 3308 CDS 100% 10.800 5.400 Y SYT15 n/a
4 TRCN0000059931 GCTGTGGTTCTCGGTGGAATA pLKO.1 2826 CDS 100% 10.800 5.400 Y SYT15 n/a
5 TRCN0000059932 AGAGGCATTGTCAGTGTGTTT pLKO.1 3307 CDS 100% 4.950 2.475 Y SYT15 n/a
6 TRCN0000380084 ATGAACCACAACAAGTTTGTC pLKO_005 3343 CDS 100% 4.950 2.475 Y SYT15 n/a
7 TRCN0000381456 CATCAACCCAGAGCTGTACAA pLKO_005 2754 CDS 100% 4.950 2.475 Y SYT15 n/a
8 TRCN0000084008 CGCCTATAATCCCAGCACTTT pLKO.1 3616 3UTR 100% 4.950 2.475 Y NPHS1 n/a
9 TRCN0000379558 AGGTGTCCAGCAAGACCATCA pLKO_005 3026 CDS 100% 4.050 2.025 Y SYT15 n/a
10 TRCN0000382517 CAATCCAAGACCAAACGCAAA pLKO_005 2968 CDS 100% 4.050 2.025 Y SYT15 n/a
11 TRCN0000382172 GGTGCTGAAGTTCTCCGTCTA pLKO_005 3054 CDS 100% 4.050 2.025 Y SYT15 n/a
12 TRCN0000381073 TTGAAGAATGAGACCCTAGTG pLKO_005 3127 CDS 100% 4.050 2.025 Y SYT15 n/a
13 TRCN0000059929 CCAATCCAAGACCAAACGCAA pLKO.1 2967 CDS 100% 2.640 1.320 Y SYT15 n/a
14 TRCN0000059930 CCCTGTGTACAATGAGACCTT pLKO.1 3402 CDS 100% 2.640 1.320 Y SYT15 n/a
15 TRCN0000059928 CCCTTGAAGAATGAGACCCTA pLKO.1 3124 CDS 100% 2.640 1.320 Y SYT15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011540437.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.