Transcript: Human XM_011540683.2

PREDICTED: Homo sapiens von Willebrand factor A domain containing 5B1 (VWA5B1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
VWA5B1 (127731)
Length:
9980
CDS:
159..3806

Additional Resources:

NCBI RefSeq record:
XM_011540683.2
NBCI Gene record:
VWA5B1 (127731)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011540683.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000343285 AGCGCAGCCTGGCTACAAATA pLKO_005 3118 CDS 100% 13.200 18.480 N VWA5B1 n/a
2 TRCN0000343290 TCTGCTATAACCCGAATTATG pLKO_005 3781 CDS 100% 13.200 18.480 N VWA5B1 n/a
3 TRCN0000343286 CCAGCGGTGGCAGATTGATTT pLKO_005 2267 CDS 100% 13.200 9.240 N VWA5B1 n/a
4 TRCN0000244670 CCATCCAGCCATGCAACTTTA pLKO_005 3975 3UTR 100% 13.200 9.240 N VWA5B1 n/a
5 TRCN0000244669 TGCAACCCAAGATGGTCAAAT pLKO_005 1720 CDS 100% 13.200 9.240 N VWA5B1 n/a
6 TRCN0000180115 CAGACGATGCTTGGAGAAGAT pLKO.1 3000 CDS 100% 4.950 2.970 N VWA5B1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011540683.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.