Transcript: Human XM_011540715.2

PREDICTED: Homo sapiens collagen type IX alpha 2 chain (COL9A2), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
COL9A2 (1298)
Length:
3387
CDS:
929..2728

Additional Resources:

NCBI RefSeq record:
XM_011540715.2
NBCI Gene record:
COL9A2 (1298)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011540715.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000412464 GACCAATGACTGAGGTCTATG pLKO_005 3136 3UTR 100% 10.800 15.120 N COL9A2 n/a
2 TRCN0000422795 TGAGGCGGCTATACCCTTAAG pLKO_005 3219 3UTR 100% 10.800 15.120 N COL9A2 n/a
3 TRCN0000083692 CCCGGGATTGATGGTTTAACT pLKO.1 884 5UTR 100% 5.625 7.875 N COL9A2 n/a
4 TRCN0000423878 GTAGAGCACTGATGGGTGAAA pLKO_005 2897 3UTR 100% 4.950 6.930 N COL9A2 n/a
5 TRCN0000083688 GCCTCCCAGCTCAGTATTTAA pLKO.1 3263 3UTR 100% 15.000 10.500 N COL9A2 n/a
6 TRCN0000430443 TCTGGAAGGCAGTGCGGATTT pLKO_005 1141 CDS 100% 10.800 7.560 N COL9A2 n/a
7 TRCN0000418271 CCTCCCTGGTGAGATTGGAAT pLKO_005 1030 CDS 100% 4.950 3.465 N COL9A2 n/a
8 TRCN0000083689 CCCTCATGGATATAAAGGCAT pLKO.1 1399 CDS 100% 2.640 1.848 N COL9A2 n/a
9 TRCN0000083690 CCAGGCATCAACGGCAAGGAT pLKO.1 1565 CDS 100% 1.000 0.700 N COL9A2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011540715.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.