Transcript: Human XM_011540884.2

PREDICTED: Homo sapiens argonaute RISC component 4 (AGO4), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
AGO4 (192670)
Length:
6024
CDS:
146..2128

Additional Resources:

NCBI RefSeq record:
XM_011540884.2
NBCI Gene record:
AGO4 (192670)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011540884.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000231981 ACAGGCAATTTGCACTATATT pLKO_005 2740 3UTR 100% 15.000 21.000 N AGO4 n/a
2 TRCN0000231980 ATACCCAGCACACGATGTATT pLKO_005 2100 CDS 100% 13.200 18.480 N AGO4 n/a
3 TRCN0000231979 CAATATGGAGGCCGGAATAAA pLKO_005 773 CDS 100% 15.000 10.500 N AGO4 n/a
4 TRCN0000007872 GCCACTGTAAATGCCTTTAAT pLKO.1 2624 3UTR 100% 15.000 10.500 N AGO4 n/a
5 TRCN0000007874 GCCTACAGCTAATAGTGGTTA pLKO.1 1059 CDS 100% 4.950 3.465 N AGO4 n/a
6 TRCN0000007875 CCTCAGAAACAATGTAGGGAA pLKO.1 890 CDS 100% 2.640 1.848 N AGO4 n/a
7 TRCN0000011205 CCAGCACCAATGCTGCAATAT pLKO.1 758 CDS 100% 1.320 0.924 N AGO4 n/a
8 TRCN0000073413 CGCCTGTAATTCCAGCACTTT pLKO.1 5091 3UTR 100% 4.950 2.475 Y LILRB1 n/a
9 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 5258 3UTR 100% 10.800 5.400 Y SMIM11A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011540884.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.