Transcript: Human XM_011541493.3

PREDICTED: Homo sapiens metal regulatory transcription factor 1 (MTF1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MTF1 (4520)
Length:
2506
CDS:
136..1923

Additional Resources:

NCBI RefSeq record:
XM_011541493.3
NBCI Gene record:
MTF1 (4520)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011541493.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000086079 GCTGCTAATCATCAAGAGTTT pLKO.1 1570 CDS 100% 4.950 6.930 N Mtf1 n/a
2 TRCN0000431351 CAGAACTTACAATGGATATTA pLKO_005 1843 CDS 100% 15.000 10.500 N MTF1 n/a
3 TRCN0000020458 CCACACCCATGCCAAGAAATA pLKO.1 467 CDS 100% 13.200 9.240 N MTF1 n/a
4 TRCN0000417007 CTCACCAGATCAGATTCATTT pLKO_005 429 CDS 100% 13.200 9.240 N MTF1 n/a
5 TRCN0000413284 GCAGCAAGCCACCACCTTAAA pLKO_005 946 CDS 100% 13.200 9.240 N MTF1 n/a
6 TRCN0000020456 GCCAACTCTGTCCTAACTAAT pLKO.1 1753 CDS 100% 13.200 9.240 N MTF1 n/a
7 TRCN0000312778 GCCAACTCTGTCCTAACTAAT pLKO_005 1753 CDS 100% 13.200 9.240 N Mtf1 n/a
8 TRCN0000020455 GCTCTCTTACAACCTCCAGAA pLKO.1 1522 CDS 100% 4.050 2.835 N MTF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011541493.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.