Transcript: Human XM_011541568.3

PREDICTED: Homo sapiens tripartite motif containing 33 (TRIM33), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TRIM33 (51592)
Length:
8430
CDS:
117..3569

Additional Resources:

NCBI RefSeq record:
XM_011541568.3
NBCI Gene record:
TRIM33 (51592)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011541568.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000304616 TCGATACCAAACTACTATAAA pLKO_005 3150 CDS 100% 15.000 21.000 N Trim33 n/a
2 TRCN0000322687 TCGATACCAAACTACTATAAA pLKO_005 3150 CDS 100% 15.000 21.000 N TRIM33 n/a
3 TRCN0000322586 GATGCTGGCTCAAGTAGTTTA pLKO_005 2253 CDS 100% 13.200 18.480 N TRIM33 n/a
4 TRCN0000022008 CGGCCCTCAATATTCCATGAT pLKO.1 1934 CDS 100% 4.950 6.930 N TRIM33 n/a
5 TRCN0000022004 GCGACTGATTACTTTCCAGTT pLKO.1 1412 CDS 100% 4.050 5.670 N TRIM33 n/a
6 TRCN0000322654 GATACTTGGTATACGAGTAAA pLKO_005 3900 3UTR 100% 13.200 9.240 N TRIM33 n/a
7 TRCN0000196330 GCTCAAGTAGTTTAGATAATC pLKO.1 2260 CDS 100% 13.200 9.240 N TRIM33 n/a
8 TRCN0000322655 TACTTTCCAGTTGCGTCATAT pLKO_005 1421 CDS 100% 13.200 9.240 N TRIM33 n/a
9 TRCN0000022006 GCTCCTGGTTATACTCCTAAT pLKO.1 1563 CDS 100% 10.800 7.560 N TRIM33 n/a
10 TRCN0000022007 CCCTCAGTTACCAATCCAGAA pLKO.1 2121 CDS 100% 4.050 2.835 N TRIM33 n/a
11 TRCN0000196351 GTACTAGTTGTGAAGACAATG pLKO.1 766 CDS 100% 0.000 0.000 N TRIM33 n/a
12 TRCN0000199476 GCCCATCTGTTACAGCAATAG pLKO.1 2092 CDS 100% 10.800 6.480 N TRIM33 n/a
13 TRCN0000022005 GCAGTTGCATTGTACTTTGAA pLKO.1 3387 CDS 100% 5.625 3.375 N TRIM33 n/a
14 TRCN0000322585 GCAGTTGCATTGTACTTTGAA pLKO_005 3387 CDS 100% 5.625 3.375 N TRIM33 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011541568.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.