Transcript: Human XM_011541877.1

PREDICTED: Homo sapiens ATP binding cassette subfamily D member 3 (ABCD3), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ABCD3 (5825)
Length:
2862
CDS:
285..1328

Additional Resources:

NCBI RefSeq record:
XM_011541877.1
NBCI Gene record:
ABCD3 (5825)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011541877.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000293931 CATTGCATAACAGCGTTTATT pLKO_005 1816 3UTR 100% 15.000 21.000 N ABCD3 n/a
2 TRCN0000293932 TTCGAGATCAAGTGATATATC pLKO_005 904 CDS 100% 13.200 18.480 N ABCD3 n/a
3 TRCN0000059850 GCCAAATACCTTGCCACTGTT pLKO.1 309 CDS 100% 4.950 6.930 N ABCD3 n/a
4 TRCN0000313758 ACTGGTGGAACACCTACATAA pLKO_005 242 5UTR 100% 13.200 10.560 N Abcd3 n/a
5 TRCN0000059851 CGACATCTCAAGAGTACACAT pLKO.1 378 CDS 100% 4.950 3.960 N ABCD3 n/a
6 TRCN0000286496 CGACATCTCAAGAGTACACAT pLKO_005 378 CDS 100% 4.950 3.960 N ABCD3 n/a
7 TRCN0000059849 GCTGCGGAAAGAGTTCACTTT pLKO.1 775 CDS 100% 4.950 3.465 N ABCD3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011541877.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.