Transcript: Human XM_011542784.2

PREDICTED: Homo sapiens glutamate ionotropic receptor kainate type subunit 4 (GRIK4), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GRIK4 (2900)
Length:
5410
CDS:
157..2865

Additional Resources:

NCBI RefSeq record:
XM_011542784.2
NBCI Gene record:
GRIK4 (2900)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011542784.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427559 GGTAGAATTGGAAGGTCTTAC pLKO_005 1053 CDS 100% 10.800 15.120 N GRIK4 n/a
2 TRCN0000063315 GCATTCTTTACCGCGTTCATA pLKO.1 1562 CDS 100% 5.625 7.875 N GRIK4 n/a
3 TRCN0000063314 CCTCCGATTCAACTACAAGAT pLKO.1 1368 CDS 100% 4.950 6.930 N GRIK4 n/a
4 TRCN0000422204 GAATCTTTGTGGTTCTTATTT pLKO_005 2414 CDS 100% 15.000 10.500 N Grik4 n/a
5 TRCN0000425845 GGGATGGTGTCAGCCTATTAC pLKO_005 859 CDS 100% 13.200 9.240 N Grik4 n/a
6 TRCN0000422658 AGGTCGAAGTGGACATCTTTG pLKO_005 344 CDS 100% 10.800 7.560 N GRIK4 n/a
7 TRCN0000434522 GTGTCAGCCTATTACACATAC pLKO_005 865 CDS 100% 10.800 7.560 N GRIK4 n/a
8 TRCN0000063316 CCAGAGATTCACAACCCTGAA pLKO.1 549 CDS 100% 4.050 2.835 N GRIK4 n/a
9 TRCN0000063317 CGCATGTGGAATTACATGTAT pLKO.1 2059 CDS 100% 0.563 0.394 N GRIK4 n/a
10 TRCN0000063313 CCGCCATTGAATATGGCACAA pLKO.1 1982 CDS 100% 0.405 0.284 N GRIK4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011542784.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.