Transcript: Human XM_011542787.2

PREDICTED: Homo sapiens glutamate ionotropic receptor kainate type subunit 4 (GRIK4), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GRIK4 (2900)
Length:
6666
CDS:
2013..4121

Additional Resources:

NCBI RefSeq record:
XM_011542787.2
NBCI Gene record:
GRIK4 (2900)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011542787.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427559 GGTAGAATTGGAAGGTCTTAC pLKO_005 2309 CDS 100% 10.800 15.120 N GRIK4 n/a
2 TRCN0000063315 GCATTCTTTACCGCGTTCATA pLKO.1 2818 CDS 100% 5.625 7.875 N GRIK4 n/a
3 TRCN0000063314 CCTCCGATTCAACTACAAGAT pLKO.1 2624 CDS 100% 4.950 6.930 N GRIK4 n/a
4 TRCN0000422204 GAATCTTTGTGGTTCTTATTT pLKO_005 3670 CDS 100% 15.000 10.500 N Grik4 n/a
5 TRCN0000063317 CGCATGTGGAATTACATGTAT pLKO.1 3315 CDS 100% 0.563 0.394 N GRIK4 n/a
6 TRCN0000063313 CCGCCATTGAATATGGCACAA pLKO.1 3238 CDS 100% 0.405 0.284 N GRIK4 n/a
7 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1345 5UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011542787.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.