Transcript: Human XM_011542790.3

PREDICTED: Homo sapiens DEAD-box helicase 25 (DDX25), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DDX25 (29118)
Length:
1730
CDS:
41..1501

Additional Resources:

NCBI RefSeq record:
XM_011542790.3
NBCI Gene record:
DDX25 (29118)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011542790.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420346 GGATTTAATAGGCCATCTAAA pLKO_005 395 CDS 100% 13.200 18.480 N DDX25 n/a
2 TRCN0000422615 ACCCTAATGTTATCAAGTTAC pLKO_005 936 CDS 100% 10.800 15.120 N DDX25 n/a
3 TRCN0000150887 GACCACTTTAACAGCAGTATT pLKO.1 1430 CDS 100% 13.200 10.560 N DDX25 n/a
4 TRCN0000435769 TCAGATCATAGTATTCGTATT pLKO_005 824 CDS 100% 10.800 8.640 N DDX25 n/a
5 TRCN0000154424 GCAACATTTATGGCAGCATCA pLKO.1 1038 CDS 100% 4.050 3.240 N DDX25 n/a
6 TRCN0000155503 CTGAACAACATCCGGCAATAT pLKO.1 974 CDS 100% 13.200 9.240 N DDX25 n/a
7 TRCN0000438407 GGATCCCAGCTCTCCACTTTA pLKO_005 310 CDS 100% 13.200 9.240 N DDX25 n/a
8 TRCN0000420428 TTTGTGCAGTATCCTAGTTTA pLKO_005 1518 3UTR 100% 13.200 9.240 N DDX25 n/a
9 TRCN0000420173 ACAGGAAAGACAGCGGCATTT pLKO_005 488 CDS 100% 10.800 7.560 N DDX25 n/a
10 TRCN0000154769 GCCTAGCTCCTACTTATGAAT pLKO.1 564 CDS 100% 5.625 3.938 N DDX25 n/a
11 TRCN0000157728 CGACGTGAAACTGTCACAGAT pLKO.1 1593 3UTR 100% 4.950 3.465 N DDX25 n/a
12 TRCN0000152333 GATGTGATGATTGACACTCAA pLKO.1 797 CDS 100% 4.950 3.465 N DDX25 n/a
13 TRCN0000155017 GCAGAGTTAATGCCTTGGAAT pLKO.1 525 CDS 100% 4.950 3.465 N DDX25 n/a
14 TRCN0000154556 GTGAACTTTGATCTCCCTGTA pLKO.1 1280 CDS 100% 4.050 2.835 N DDX25 n/a
15 TRCN0000157148 GTGAGAATGTCTCAGTGGGTT pLKO.1 1540 3UTR 100% 2.640 1.848 N DDX25 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011542790.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.