Transcript: Human XM_011542968.3

PREDICTED: Homo sapiens transient receptor potential cation channel subfamily C member 6 (TRPC6), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TRPC6 (7225)
Length:
4315
CDS:
200..2830

Additional Resources:

NCBI RefSeq record:
XM_011542968.3
NBCI Gene record:
TRPC6 (7225)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011542968.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000044107 CGCTCCACAAGCCTATCTATA pLKO.1 305 CDS 100% 13.200 18.480 N TRPC6 n/a
2 TRCN0000432575 GATCCAGTCATGACGGCTTTA pLKO_005 908 CDS 100% 10.800 15.120 N TRPC6 n/a
3 TRCN0000044106 CCAGAGCATCATTGACGCAAA pLKO.1 1696 CDS 100% 4.050 5.670 N TRPC6 n/a
4 TRCN0000068394 GCTCATTATATCCTGGGTAAT pLKO.1 1522 CDS 100% 10.800 8.640 N Trpc6 n/a
5 TRCN0000044105 CCAATGAGCATCTGGAAATTA pLKO.1 459 CDS 100% 15.000 10.500 N TRPC6 n/a
6 TRCN0000417513 CCCAAATCTCAGCCGTTTAAA pLKO_005 1114 CDS 100% 15.000 10.500 N TRPC6 n/a
7 TRCN0000431016 GTCCACTTGAAGCCATATTAT pLKO_005 2864 3UTR 100% 15.000 10.500 N TRPC6 n/a
8 TRCN0000044103 CCTGGGTAATAGGCATGATAT pLKO.1 1533 CDS 100% 13.200 9.240 N TRPC6 n/a
9 TRCN0000044104 GCACAATAAACAACCAAGTAT pLKO.1 2524 CDS 100% 5.625 3.938 N TRPC6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011542968.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.