Transcript: Human XM_011543142.2

PREDICTED: Homo sapiens interleukin 31 receptor A (IL31RA), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
IL31RA (133396)
Length:
8050
CDS:
122..2320

Additional Resources:

NCBI RefSeq record:
XM_011543142.2
NBCI Gene record:
IL31RA (133396)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011543142.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000061615 CCCAGTACACAGTTAAGAGAA pLKO.1 273 CDS 100% 4.950 6.930 N IL31RA n/a
2 TRCN0000061614 CCTGAAACGAAAGACCTCTTA pLKO.1 1570 CDS 100% 4.950 6.930 N IL31RA n/a
3 TRCN0000061616 CCAGCATAAATTTCAAGACAT pLKO.1 1638 CDS 100% 4.950 3.960 N IL31RA n/a
4 TRCN0000061617 CCAAGAATAACGATCCCAGAT pLKO.1 377 CDS 100% 4.050 3.240 N IL31RA n/a
5 TRCN0000061613 CGCCTGTTTCATCTGATTTAA pLKO.1 570 CDS 100% 15.000 10.500 N IL31RA n/a
6 TRCN0000412508 CATCAAACGAATGATTCAAAT pLKO_005 526 CDS 100% 13.200 9.240 N IL31RA n/a
7 TRCN0000427741 TTTCCTGTGTCTACTACTATA pLKO_005 204 CDS 100% 13.200 9.240 N IL31RA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011543142.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13175 pDONR223 100% 84.9% 84.9% None 1_330del n/a
Download CSV