Transcript: Human XM_011543373.3

PREDICTED: Homo sapiens interleukin 5 (IL5), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
IL5 (3567)
Length:
3339
CDS:
318..722

Additional Resources:

NCBI RefSeq record:
XM_011543373.3
NBCI Gene record:
IL5 (3567)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011543373.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000058734 GCAAGAGTTTCTTGGTGTAAT pLKO.1 674 CDS 100% 13.200 18.480 N IL5 n/a
2 TRCN0000378747 GGGTACTGTGGAAAGACTATT pLKO_005 560 CDS 100% 13.200 18.480 N IL5 n/a
3 TRCN0000058736 CCGAGTGGATAATAGAAAGTT pLKO.1 700 CDS 100% 5.625 7.875 N IL5 n/a
4 TRCN0000058737 CGAACTCTGCTGATAGCCAAT pLKO.1 438 CDS 100% 4.050 5.670 N IL5 n/a
5 TRCN0000058733 CGGAGAGTAAACCAATTCCTA pLKO.1 645 CDS 100% 3.000 4.200 N IL5 n/a
6 TRCN0000372663 GAAAGAGTCAGGCCTTAATTT pLKO_005 796 3UTR 100% 15.000 10.500 N IL5 n/a
7 TRCN0000372755 GATTCCTGTTCCTGTACATAA pLKO_005 470 CDS 100% 13.200 9.240 N IL5 n/a
8 TRCN0000058735 CACTGCTTTCTACTCATCGAA pLKO.1 421 CDS 100% 3.000 2.100 N IL5 n/a
9 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3292 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011543373.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06439 pDONR223 99.5% 100% 100% None n/a
2 ccsbBroad304_06439 pLX_304 0% 100% 100% V5 n/a
Download CSV