Transcript: Human XM_011543544.2

PREDICTED: Homo sapiens endoplasmic reticulum aminopeptidase 2 (ERAP2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ERAP2 (64167)
Length:
5080
CDS:
169..2982

Additional Resources:

NCBI RefSeq record:
XM_011543544.2
NBCI Gene record:
ERAP2 (64167)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011543544.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431696 AGGACTTGGCTAATGGTTAAT pLKO_005 2956 CDS 100% 13.200 18.480 N ERAP2 n/a
2 TRCN0000422794 GCGTTACCTTCTTCAGTATTT pLKO_005 2268 CDS 100% 13.200 18.480 N ERAP2 n/a
3 TRCN0000073849 CCCGACTCAAATACAGGAAAT pLKO.1 1494 CDS 100% 10.800 8.640 N ERAP2 n/a
4 TRCN0000426483 GACCTCTTCTGCTTCCGATAA pLKO_005 1230 CDS 100% 10.800 7.560 N ERAP2 n/a
5 TRCN0000073850 CCGTTGTTCAAAGCCAACTTT pLKO.1 808 CDS 100% 5.625 3.938 N ERAP2 n/a
6 TRCN0000073851 GAGCTGCAATTTGATGACTAT pLKO.1 1396 CDS 100% 4.950 3.465 N ERAP2 n/a
7 TRCN0000073852 CCACTCTCCAAACTGGATTTA pLKO.1 1123 CDS 100% 13.200 7.920 N ERAP2 n/a
8 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 3021 3UTR 100% 4.950 2.475 Y ERAP2 n/a
9 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3022 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011543544.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.