Transcript: Human XM_011543845.3

PREDICTED: Homo sapiens tankyrase (TNKS), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TNKS (8658)
Length:
8199
CDS:
711..4661

Additional Resources:

NCBI RefSeq record:
XM_011543845.3
NBCI Gene record:
TNKS (8658)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011543845.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000040186 GCCAGGGATAACTGGAACTAT pLKO.1 1539 CDS 100% 5.625 7.875 N TNKS n/a
2 TRCN0000333000 GCCAGGGATAACTGGAACTAT pLKO_005 1539 CDS 100% 5.625 7.875 N TNKS n/a
3 TRCN0000018346 CATCACAATGAGCGCATGTTG pLKO.1 4236 CDS 100% 4.950 6.930 N TNKS n/a
4 TRCN0000040184 CGACTCTTAGAGGCATCTAAA pLKO.1 2667 CDS 100% 1.320 1.848 N TNKS n/a
5 TRCN0000040183 CGCTTCATAATGCCTGTTCTT pLKO.1 1465 CDS 100% 4.950 6.435 N TNKS n/a
6 TRCN0000040185 GCTCCAGAAGATAAAGAATAT pLKO.1 4044 CDS 100% 13.200 9.240 N TNKS n/a
7 TRCN0000333002 GCTCCAGAAGATAAAGAATAT pLKO_005 4044 CDS 100% 13.200 9.240 N TNKS n/a
8 TRCN0000018345 GAACTATACACCTCTGCATGA pLKO.1 1553 CDS 100% 4.050 2.835 N TNKS n/a
9 TRCN0000040187 GCCCATAATGATGTCATGGAA pLKO.1 2415 CDS 100% 3.000 2.100 N TNKS n/a
10 TRCN0000332938 GCCCATAATGATGTCATGGAA pLKO_005 2415 CDS 100% 3.000 2.100 N TNKS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011543845.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.