Transcript: Human XM_011544136.2

PREDICTED: Homo sapiens ATP binding cassette subfamily B member 10 (ABCB10), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ABCB10 (23456)
Length:
3094
CDS:
169..1497

Additional Resources:

NCBI RefSeq record:
XM_011544136.2
NBCI Gene record:
ABCB10 (23456)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011544136.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000231039 CATCGTCTGTCCACCATTAAG pLKO_005 1348 CDS 100% 13.200 18.480 N ABCB10 n/a
2 TRCN0000231040 TAACCCTTTATTCCGATAATC pLKO_005 1967 3UTR 100% 13.200 18.480 N ABCB10 n/a
3 TRCN0000218024 GGAGTTTAAGAACGTGCATTT pLKO_005 756 CDS 100% 10.800 8.640 N ABCB10 n/a
4 TRCN0000060177 CGGTTGGATTTCTCACGATGT pLKO.1 4 5UTR 100% 4.050 3.240 N ABCB10 n/a
5 TRCN0000231038 AGTGGCCTTCATCCGGAATTT pLKO_005 1116 CDS 100% 13.200 9.240 N ABCB10 n/a
6 TRCN0000231037 AGCTAGCTGAGGAACGTATTG pLKO_005 335 CDS 100% 10.800 7.560 N ABCB10 n/a
7 TRCN0000060176 CCATGACATCCGTCAGCTAAA pLKO.1 945 CDS 100% 10.800 7.560 N ABCB10 n/a
8 TRCN0000060173 GCTGTAATTTATGGGCGATAT pLKO.1 265 CDS 100% 10.800 7.560 N ABCB10 n/a
9 TRCN0000060175 CCAGCAAAGTGGACCATGTAA pLKO.1 413 CDS 100% 5.625 3.938 N ABCB10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011544136.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.