Transcript: Human XM_011544730.2

PREDICTED: Homo sapiens reticulon 3 (RTN3), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RTN3 (10313)
Length:
5004
CDS:
278..3391

Additional Resources:

NCBI RefSeq record:
XM_011544730.2
NBCI Gene record:
RTN3 (10313)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011544730.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430190 ACGGAATCACCCTTCTAATTC pLKO_005 3201 CDS 100% 13.200 18.480 N RTN3 n/a
2 TRCN0000203728 CCGAGATTCAAATCTCCGATT pLKO.1 4328 3UTR 100% 0.405 0.567 N RTN3 n/a
3 TRCN0000164038 CCCGAGATTCAAATCTCCGAT pLKO.1 4327 3UTR 100% 0.264 0.370 N RTN3 n/a
4 TRCN0000186563 GCCCACCTCAAGTTTAATAAA pLKO.1 4119 3UTR 100% 15.000 10.500 N RTN3 n/a
5 TRCN0000414658 CCTACCTGGACGTAGACATTA pLKO_005 3018 CDS 100% 13.200 9.240 N RTN3 n/a
6 TRCN0000428221 TCAGAAGCTTTCCATAATTAC pLKO_005 3047 CDS 100% 13.200 9.240 N RTN3 n/a
7 TRCN0000203633 CCCGATTGTCTATGAGAAGTA pLKO.1 3247 CDS 100% 4.950 3.465 N RTN3 n/a
8 TRCN0000164520 CGTCATCCAAGCTGTACAGAA pLKO.1 2971 CDS 100% 4.950 3.465 N RTN3 n/a
9 TRCN0000430803 CTTTGGCACCACGCTGATCAT pLKO_005 2854 CDS 100% 4.950 3.465 N RTN3 n/a
10 TRCN0000159418 GAAACTCATTATTCGTCTCTT pLKO.1 3103 CDS 100% 4.950 3.465 N RTN3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011544730.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02397 pDONR223 100% 18.6% 15.2% None (many diffs) n/a
2 ccsbBroad304_02397 pLX_304 0% 18.6% 15.2% V5 (many diffs) n/a
Download CSV